Int J Stomatol

Inter J Stomatol ›› 2018, Vol. 45 ›› Issue (6): 628-634.doi: 10.7518/gjkq.2018.06.002

• RNA Research • Previous Articles     Next Articles

Effects of long non-coding RNA lnc-p26090 on the glycolysis and proliferation in oral squamous cell carcinoma

Yuanyuan Li,Bin Cheng,Yun Wang()   

  1. Guanghua School of Stomatology, Hospital of Stomatology, Sun Yat-sen University, Guangdong Provincial Key Laboratory of Stomatology, Guangzhou 510055, China
  • Received:2018-04-02 Revised:2018-08-10 Online:2018-11-01 Published:2018-11-15
  • Contact: Yun Wang E-mail:wangyun23@mail.sysu.edu.cn
  • Supported by:
    This study was supported by National Natural Science Foundation of China(81502356);Science and Technology Program of Guangzhou(201804010040)

RichHTML

22

PDF (PC)

281

Abstract:

Objective To investigate the long non-coding RNA lnc-p26090 expression level in oral squamous cell carcinoma (OSCC) tissues and cell lines. To explore the effect of lnc-p26090 on OSCC cells glycolysis and proliferation.Methods Real-time quantitative polymerase chain reaction (RT-qPCR) was used to detect the relative expression level of lnc-p26090 in OSCC tissues and cell lines. Then we searched the UCSC and LNCipedia websites to obtain the chromosome location and protein coding capacity of lnc-p26090. Moreover, we transfected the plasmid into HEK 293T cell to confirm the protein coding capacity of lnc-p26090. After silencing lnc-p26090 in OSCC cell lines, we detected the glucose consumption, lactic acid production and expression level of glycolysis related genes. Furthermore, cell counting kit-8 (CCK-8) assay, flow cytometry and western blot were performed to examine the effect of lnc-p26090 on proli-feration and cell cycle distribution.Results lnc-p26090 was highly expressed both in OSCC tissues and cell lines. lnc-p26090 located in chro-mosome 2p11.2, without protein coding capacity. Silencing lnc-p26090 significantly repressed the glucose consumption, lactic acid production of cells. Moreover, the expression level of glycolysis related genes: pyruvate kinase M2, phosphofructokinase M, hexokinase 2, glucose transporter 1 and lactate dehydrogenase A were decreased after lnc- p26090 knockdown in cells. Furthermore, when downregulating lnc-p26090 in cells, proliferation was inhibited, and cell-cycle was blocked in G1 phase. At the meanwhile, cyclin D1 and cyclin-dependent kinase 4 expression level was decreased and p21 was increased significantly.Conclusion lnc-p26090, which located in chromosome 2p11.2, was upregulated in OSCC tissues and cell lines. It could be involved in the glycolysis and proliferation of OSCC.

Key words: oral squamous cell carcinoma, long non-coding RNA, glycolysis, proliferation

CLC Number: 

  • R739.8

TrendMD: 

Tab 1

Primers for RT-qPCR analysis"

基因 上游引物（5’- 3’） 下游引物（5’- 3’） 扩增产物大小/bp
lnc-p26090 TGCCCTGTGATTATCCGCAAAC CAGATGGCGGGAAGATGAAGAC 124
PKM2 CCACTTGCAATTATTTGAGGAA GTGAGCAGACCTGCCAGACT 153
PFKM GCCAGTCTAATTGCCGTTCC TACCAACTCGAACCACAGCC 174
HK2 TCAGATTGAGAGTGACTGCC TTTCTCGTATCCTGTCCACC 179
GLUT1 CCATCCTTCCTGCTATCCTAC GACATCCTTGCACTCTCATC 178
LDHA GTGGCTTGGAAGATAAGTGG CATACAGGCACACTGGAATC 167
GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 165

Fig 1

The expression level of lnc-p26090"

Fig 2

The chromosome position and protein coding capacity of lnc-p26090"

Fig 3

The effect of lnc-p26090 on HSC-3 and SCC-25 cell lines glycolysis"

Fig 4

The effect of lnc-p26090 on HSC-3, SCC-25 cell lines proliferation"

[1] Choi S, Myers JN . Molecular pathogenesis of oral squamous cell carcinoma: implications for therapy[J]. J Dent Res, 2008,87(1):14-32.
doi: 10.1177/154405910808700104 pmid: 18096889
[2] Ayala FR, Rocha RM, Carvalho KC , et al. GLUT1 and GLUT3 as potential prognostic markers for oral squamous cell carcinoma[J]. Molecules, 2010,15(4):2374-2387.
doi: 10.3390/molecules15042374 pmid: 20428049
[3] Wang Y, Zhang X, Zhang Y , et al. Overexpression of pyruvate kinase M2 associates with aggressive clini-copathological features and unfavorable pro-gnosis in oral squamous cell carcinoma[J]. Cancer Biol Ther, 2015,16(6):839-845.
doi: 10.1080/15384047.2015.1030551 pmid: 25970228
[4] Bergmann JH, Spector DL . Long non-coding RNAs: modulators of nuclear structure and function[J]. Curr Opin Cell Biol, 2014,26:10-18.
doi: 10.1016/j.ceb.2013.08.005
[5] Cech TR, Steitz JA . The noncoding RNA revolution-trashing old rules to forge new ones[J]. Cell, 2014,157(1):77-94.
doi: 10.1016/j.cell.2014.03.008 pmid: 24679528
[6] Martens-Uzunova ES, Böttcher R, Croce CM , et al. Long noncoding RNA in prostate, bladder, and kid-ney cancer[J]. Eur Urol, 2014,65(6):1140-1151.
doi: 10.1016/j.eururo.2013.12.003 pmid: 24373479
[7] Zhang X, Li Y, Li X , et al. Long non-coding RNA P4713 contributes to the malignant phenotypes of oral squamous cell carcinoma by activating the JAK/STAT3 pathway[J]. Int J Clin Exp Pathol, 2017,10(11):10947-10958.
[8] Hanahan D, Weinberg RA . Hallmarks of cancer: the next generation[J]. Cell, 2011,144(5):646-674.
doi: 10.1016/j.cell.2011.02.013 pmid: 21376230
[9] El Mjiyad N, Caro-Maldonado A, Ramírez-Peinado S , et al. Sugar-free approaches to cancer cell killing[J]. Oncogene, 2011,30(3):253-264.
doi: 10.1038/onc.2010.466 pmid: 20972457
[10] Levine AJ, Puzio-Kuter AM . The control of the meta- bolic switch in cancers by oncogenes and tumor sup-pressor genes[J]. Science, 2010,330(6009):1340-1344.
doi: 10.1126/science.1193494
[11] Gammon L, Biddle A, Heywood HK , et al. Sub-sets of cancer stem cells differ intrinsically in their pat-terns of oxygen metabolism[J]. PLoS One, 2013,8(4):e62493.
doi: 10.1371/journal.pone.0062493 pmid: 23638097
[12] Bochenek G, Häsler R, El Mokhtari NE , et al. The large non-coding RNA ANRIL, which is associated with atherosclerosis, periodontitis and several forms of cancer, regulates ADIPOR1, VAMP3 and C11ORF10[J]. Hum Mol Genet, 2013,22(22):4516-4527.
doi: 10.1093/hmg/ddt299
[13] Goncalves MD, Cantley LC . A glycolysis outsider steps into the cancer spotlight[J]. Cell Metab, 2018,28(1):3-4.
doi: 10.1016/j.cmet.2018.06.017
[14] Coelho RG, Fortunato RS, Carvalho DP . Metabolic reprogramming in thyroid carcinoma[J]. Front Oncol, 2018,8:82.
doi: 10.3389/fonc.2018.00082
[15] Rupaimoole R, Lee J, Haemmerle M , et al. Long noncoding RNA ceruloplasmin promotes cancer growth by altering glycolysis[J]. Cell Rep, 2015,13(11):2395-2402.
doi: 10.1016/j.celrep.2015.11.047 pmid: 4691557
[16] Bian Z, Zhang J, Li M , et al. LncRNA-FEZF1-AS1 promotes tumor proliferation and metastasis in co-lorectal cancer by regulating PKM2 signaling[J]. Clin Cancer Res, 2018. doi: 10.1158/1078-0432.CCR-17- 2967.
doi: 10.1158/1078-0432.CCR-17-2967 pmid: 29914894
[17] Johnson DG, Walker CL . Cyclins and cell cycle checkpoints[J]. Annu Rev Pharmacol Toxicol, 1999,39:295-312.
doi: 10.1146/annurev.pharmtox.39.1.295 pmid: 10331086
[18] Bloom J, Cross FR . Multiple levels of cyclin speci-ficity in cell-cycle control[J]. Nat Rev Mol Cell Biol, 2007,8(2):149-160.
doi: 10.1038/nrm2105 pmid: 17245415
[19] Yao F, Zhao T, Zhong C , et al. LDHA is necessary for the tumorigenicity of esophageal squamous cell carcinoma[J]. Tumour Biol, 2013,34(1):25-31.
doi: 10.1007/s13277-012-0506-0 pmid: 22961700
[20] Xiao H, Wang J, Yan W , et al. GLUT1 regulates cell glycolysis and proliferation in prostate cancer[J]. Prostate, 2018,78(2):86-94.
doi: 10.1002/pros.23448 pmid: 29105798
[1] Zhou Jinkuo,Zhang Jinhong,Shi Xiaojing,Liu Guangshun,Jiang Lei,Liu Qianfeng. Influences of long noncoding RNA small nucleolar RNA host gene 22 on the cell proliferation, invasion and migration of oral squamous carcinoma cells by regulating microRNA-27b-3p [J]. Int J Stomatol, 2024, 51(1): 52-59.
[2] Li Liheng,Wang Rui,Wang Xiaoming,Zhang Zhiyi,Zhang Xuan,An Feng,Wang Qin,Zhang Fan. Effects of circular RNA hsa_circ_0085576 on cell migration and invasion of oral squamous cell carcinoma by regulating the microRNA-498/B-cell-specific Moloney murine leukemia virus integration site 1 axis [J]. Int J Stomatol, 2024, 51(1): 60-67.
[3] Wu Jiamin,Xia Bin,Yang Hefeng,Xu Biao.. Research progress on cancer-associated fibroblasts in the tumor microenvironment of oral squamous cell carcinoma [J]. Int J Stomatol, 2023, 50(6): 711-717.
[4] Liu Jianglong, Tuerdi Maimaitituxun. Progress of contrast-enhanced ultrasound in the diagnosis of cervical lymph node metastasis from oral squamous cell carcinoma [J]. Int J Stomatol, 2023, 50(5): 514-520.
[5] Sheng Nanning,Wang Jue,Nan Xinrong. Research progress on mechanism and treatment of sex-determining region Y box 9 in oral squamous cell carcinoma [J]. Int J Stomatol, 2023, 50(3): 314-320.
[6] Li Tan,Liang Xin-hua.. Role of discoidin domain receptor 1 in the regulation of malignant tumor progression and therapy [J]. Int J Stomatol, 2023, 50(2): 230-236.
[7] Zhao Zhuoping,Xin Pengfei,Gao Yang,Zhang Caifeng,Zhang Kuanshou,Liu Qingmei. Research progress on the use of photothermal therapy to treat oral squamous cell carcinoma [J]. Int J Stomatol, 2022, 49(4): 462-470.
[8] Jiang Han,Shen Yingqiang,Chen Qianming. Experimental study of muscarinic receptors on the biological behavior of oral squamous cell carcinoma through Yes related protein signal [J]. Int J Stomatol, 2022, 49(2): 138-143.
[9] Xiong Menglin,Wu Long,Ma Li,Zhao Jin. Role of transforming growth factor-β2 in promoting the proliferation and differentiation of dental pulp stem cells [J]. Int J Stomatol, 2021, 48(6): 635-639.
[10] Jiang Yulei,Xia Bin,Rao Nanquan,Yang Hefeng,Xu Biao. Exosomes mediate the malignant progression of oral squamous cell carcinoma and its application in diagnosis and treatment [J]. Int J Stomatol, 2021, 48(6): 711-717.
[11] Liu Juan,Chen Bin,Yan Fuhua. Effects of platelet-rich plasma and concentrated growth factor on the proliferation and osteogenic differentiation of human periodontal cells [J]. Int J Stomatol, 2021, 48(5): 520-527.
[12] Gan Jianguo,Gao Pan,Wang Xiaoyi. Research progress on the relationship between circulating tumor cells and oral squamous cell carcinoma [J]. Int J Stomatol, 2021, 48(2): 205-212.
[13] Huang Junwen,Qiao Jie,Mei Zi,Chen Zhuo,Li Yang,Qiao Bin. Expression and clinical significance of lipopolysaccharide binding protein in oral squamous cell carcinoma [J]. Int J Stomatol, 2021, 48(1): 50-57.
[14] He Yuqing,Dan Hongxia,Chen Qianming. Application of photodynamic therapy for oral carcinogenesis prevention [J]. Int J Stomatol, 2020, 47(6): 669-676.
[15] Hao Fu,Ning Yi,Sun Rui,Zheng Xiaoxu. Expression and potential clinical significance of Transformer 2β in oral squamous cell carcinoma [J]. Int J Stomatol, 2020, 47(2): 159-165.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] . [J]. Foreign Med Sci: Stomatol, 1999, 26(06): .
[2] . [J]. Foreign Med Sci: Stomatol, 1999, 26(06): .
[3] . [J]. Foreign Med Sci: Stomatol, 1999, 26(06): .
[4] . [J]. Foreign Med Sci: Stomatol, 1999, 26(06): .
[5] . [J]. Foreign Med Sci: Stomatol, 1999, 26(06): .
[6] . [J]. Foreign Med Sci: Stomatol, 1999, 26(05): .
[7] . [J]. Foreign Med Sci: Stomatol, 1999, 26(05): .
[8] . [J]. Foreign Med Sci: Stomatol, 1999, 26(05): .
[9] . [J]. Foreign Med Sci: Stomatol, 1999, 26(04): .
[10] . [J]. Foreign Med Sci: Stomatol, 1999, 26(04): .