Int J Stomatol

Int J Stomatol ›› 2022, Vol. 49 ›› Issue (2): 138-143.doi: 10.7518/gjkq.2022016

• Original Articles • Previous Articles     Next Articles

Experimental study of muscarinic receptors on the biological behavior of oral squamous cell carcinoma through Yes related protein signal

Jiang Han(),Shen Yingqiang(),Chen Qianming   

  1. State Key Laboratory of Oral Diseases & National Clinical Research Center for Oral Diseases & National Key Laboratory of Oral Mucosal Diseases & Innovation Unit of Oral Mucosal Carcinogenesis and Prevention, Chinese Academy of Medical Sciences & Dept. of Oral Medicine, West China Hospital of Stomatology, Sichuan University, Chengdu 610041, China
  • Received:2021-04-25 Revised:2021-12-01 Online:2022-03-01 Published:2022-03-15
  • Contact: Yingqiang Shen E-mail:2177668395@qq.com;shen@scu.edu.cn
  • Supported by:
    Research Funding from West China School/Hospital of Stomatology Sichuan University(RCDWJS2020-20)

RichHTML

24

PDF (PC)

114

Abstract:

Objective This study aims to study the role and mechanism of muscarinic (m) receptors in oral squamous cell carcinoma (OSCC). Methods The study involved a query on The Cancer Gene Atlas (TCGA) database of head and neck cancer and used real-time quantitative polymerase chain reaction (RT-qPCR) to detect the expression level of m receptor genes in OSCC cells. The m receptor agonist Carbachol was used to further study the proliferation of OSCC cells. Immunofluorescence was used to explore the influence of activated m receptor on the localization of Yes related protein (YAP) in OSCC cells. Results The expression of m receptor genes was different in HNSC. Specifically, chrm3 was highly expressed in HN4 and HN12 (P<0.05). The activation of m receptor can promote OSCC cell proliferation and invasion. Promoting the nuclear translocation of YAP may be the mechanism of m receptor. Conclusion The m receptors are essential for the occurrence and development of OSCC, and targeting m receptors may be a new strategy for the treatment of OSCC in the future.

Key words: muscarinic receptors, oral squamous cell carcinoma, Carbachol

CLC Number: 

  • R739.8

TrendMD: 

Tab 1

Primer sequence of m receptor genes"

基因 正向引物（5’-3’） 反向引物（5’-3’）
chrm1 TGACCGCTACTTCTCCG-TGACT CCAGAGCACAAAGGAAACCA
chrm3 ACCATCCCTCAACTCCA-CCAAGT GGAAAACTGCCTCCATCGTC
chrm5 GAAAGCAGCCCAGACA-CTGA AGCACAACCAACAGCCCAAG
gapdh CCTGTTCGATCAGCCG CGACCAAATCCGTTGACTCC

Fig 1

The expression of m receptor subtype genes and survival analysis in TCGA database"

Fig 2

The expression of m receptor subtype genes in OSCC cells"

Fig 3

Carbachol on the proliferation and invasion ability of HN12 and HSC-4 cells at different concentrations"

Fig 4

The effect of Carbachol on the nuclear translocation of YAP in OSCC cells"

Fig 5

The expression level of YAP and p-YAP in OSCC cells after treatment with Carbachol"

[1] Lindemann A, Takahashi H, Patel AA, et al. Targeting the DNA damage response in OSCC with TP53 mutations[J]. J Dent Res, 2018, 97(6): 635-644.
doi: 10.1177/0022034518759068 pmid: 29489434
[2] Cramer JD, Burtness B, Ferris RL. Immunotherapy for head and neck cancer: recent advances and future directions[J]. Oral Oncol, 2019, 99: 104460.
doi: S1368-8375(19)30371-9 pmid: 31683169
[3] Gutkind JS, Novotny EA, Brann MR, et al. Muscarinic acetylcholine receptor subtypes as agonist-dependent oncogenes[J]. Proc Natl Acad Sci U S A, 1991, 88(11): 4703-4707.
pmid: 1905013
[4] Ventura S, Pennefather J, Mitchelson F. Cholinergic innervation and function in the prostate gland[J]. Pharmacol Ther, 2002, 94(1/2): 93-112.
doi: 10.1016/S0163-7258(02)00174-2
[5] Magnon C, Hall SJ, Lin J, et al. Autonomic nerve development contributes to prostate cancer progression[J]. Science, 2013, 341(6142): 1236361.
doi: 10.1126/science.1236361
[6] Goto Y, Ando T, Izumi H, et al. Muscarinic receptors promote castration-resistant growth of prostate cancer through a FAK-YAP signaling axis[J]. Oncogene, 2020, 39(20): 4014-4027.
doi: 10.1038/s41388-020-1272-x
[7] Renz BW, Tanaka T, Sunagawa M, et al. Cholinergic signaling via muscarinic receptors directly and indirectly suppresses pancreatic tumorigenesis and cancer stemness[J]. Cancer Discov, 2018, 8(11): 1458-1473.
doi: 10.1158/2159-8290.CD-18-0046
[8] Kamiya A, Hayama Y, Kato S, et al. Genetic manipulation of autonomic nerve fiber innervation and activity and its effect on breast cancer progression[J]. Nat Neurosci, 2019, 22(8): 1289-1305.
[9] Moroishi T, Hansen CG, Guan KL. The emerging roles of YAP and TAZ in cancer[J]. Nat Rev Cancer, 2015, 15(2): 73-79.
doi: 10.1038/nrc3876 pmid: 25592648
[10] Dong JX, Feldmann G, Huang JB, et al. Elucidation of a universal size-control mechanism in drosophila and mammals[J]. Cell, 2007, 130(6): 1120-1133.
doi: 10.1016/j.cell.2007.07.019
[1] Zhou Jinkuo,Zhang Jinhong,Shi Xiaojing,Liu Guangshun,Jiang Lei,Liu Qianfeng. Influences of long noncoding RNA small nucleolar RNA host gene 22 on the cell proliferation, invasion and migration of oral squamous carcinoma cells by regulating microRNA-27b-3p [J]. Int J Stomatol, 2024, 51(1): 52-59.
[2] Li Liheng,Wang Rui,Wang Xiaoming,Zhang Zhiyi,Zhang Xuan,An Feng,Wang Qin,Zhang Fan. Effects of circular RNA hsa_circ_0085576 on cell migration and invasion of oral squamous cell carcinoma by regulating the microRNA-498/B-cell-specific Moloney murine leukemia virus integration site 1 axis [J]. Int J Stomatol, 2024, 51(1): 60-67.
[3] Wu Jiamin,Xia Bin,Yang Hefeng,Xu Biao.. Research progress on cancer-associated fibroblasts in the tumor microenvironment of oral squamous cell carcinoma [J]. Int J Stomatol, 2023, 50(6): 711-717.
[4] Liu Jianglong, Tuerdi Maimaitituxun. Progress of contrast-enhanced ultrasound in the diagnosis of cervical lymph node metastasis from oral squamous cell carcinoma [J]. Int J Stomatol, 2023, 50(5): 514-520.
[5] Sheng Nanning,Wang Jue,Nan Xinrong. Research progress on mechanism and treatment of sex-determining region Y box 9 in oral squamous cell carcinoma [J]. Int J Stomatol, 2023, 50(3): 314-320.
[6] Li Tan,Liang Xin-hua.. Role of discoidin domain receptor 1 in the regulation of malignant tumor progression and therapy [J]. Int J Stomatol, 2023, 50(2): 230-236.
[7] Zhao Zhuoping,Xin Pengfei,Gao Yang,Zhang Caifeng,Zhang Kuanshou,Liu Qingmei. Research progress on the use of photothermal therapy to treat oral squamous cell carcinoma [J]. Int J Stomatol, 2022, 49(4): 462-470.
[8] Jiang Yulei,Xia Bin,Rao Nanquan,Yang Hefeng,Xu Biao. Exosomes mediate the malignant progression of oral squamous cell carcinoma and its application in diagnosis and treatment [J]. Int J Stomatol, 2021, 48(6): 711-717.
[9] Gan Jianguo,Gao Pan,Wang Xiaoyi. Research progress on the relationship between circulating tumor cells and oral squamous cell carcinoma [J]. Int J Stomatol, 2021, 48(2): 205-212.
[10] Huang Junwen,Qiao Jie,Mei Zi,Chen Zhuo,Li Yang,Qiao Bin. Expression and clinical significance of lipopolysaccharide binding protein in oral squamous cell carcinoma [J]. Int J Stomatol, 2021, 48(1): 50-57.
[11] He Yuqing,Dan Hongxia,Chen Qianming. Application of photodynamic therapy for oral carcinogenesis prevention [J]. Int J Stomatol, 2020, 47(6): 669-676.
[12] Hao Fu,Ning Yi,Sun Rui,Zheng Xiaoxu. Expression and potential clinical significance of Transformer 2β in oral squamous cell carcinoma [J]. Int J Stomatol, 2020, 47(2): 159-165.
[13] Xue Lingli,Li Yadong. Survival analysis of patients with oral squamous cell carcinoma treated by radical surgery for the first time [J]. Int J Stomatol, 2020, 47(2): 166-174.
[14] Chen Hongli,Yang Jing,Yin Gang,Li Haoyuan,Qiao Yan. Expression of zinc finger protein 32 in oral squamous cell carcinoma and its effect on oral squamous cell carcinoma stem cells [J]. Int J Stomatol, 2019, 46(6): 631-639.
[15] Bing Yan,Xianyang Luo,Yingyun Tan,Limei Guan,Lili Xue. Research on the surface-enhanced Raman spectrum of blood serum for clinical staging of oral squamous cell carcinoma [J]. Int J Stomatol, 2019, 46(3): 277-281.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] . [J]. Foreign Med Sci: Stomatol, 1999, 26(06): .
[2] . [J]. Foreign Med Sci: Stomatol, 1999, 26(06): .
[3] . [J]. Foreign Med Sci: Stomatol, 1999, 26(05): .
[4] . [J]. Foreign Med Sci: Stomatol, 1999, 26(05): .
[5] . [J]. Foreign Med Sci: Stomatol, 1999, 26(05): .
[6] . [J]. Foreign Med Sci: Stomatol, 1999, 26(04): .
[7] . [J]. Foreign Med Sci: Stomatol, 1999, 26(04): .
[8] . [J]. Foreign Med Sci: Stomatol, 1999, 26(04): .
[9] . [J]. Foreign Med Sci: Stomatol, 1999, 26(04): .
[10] . [J]. Foreign Med Sci: Stomatol, 1999, 26(04): .